Ways To Ensure Experimental Consistency #3

Commercial Kits

There are many commercial kits available to streamline and simplify various experimental procedures including DNA/RNA extraction, plasmid preparation, cloning, immunoassays, reporter assays, and so forth.

Commercially available kits are certified for quality and have proven efficacy so long as the instructions for use and handling are adhered to. However, there are a few important points to note in regards to reagent and sample preparation, points that some product manuals may not necessarily provide information on. 

* Ensure that components of buffers and reagents are in solution. With some buffers, you may see precipitates. For example, lysis buffers containing SDS tend to develop white precipitates when the room temperature is low. This is the SDS falling out of solution. In such instances, warm up the buffer in a water bath before use. 

* Ensure correct storage of kit components. Make sure that after opening and using individual kit components that they are stored at the recommended temperature. While a kit may arrive at room temperature, after a buffer is opened it may need to be stored at 4 degrees.

* Note the expiry date of the kit and/or specific components.

* If you are required to prepare a component that is not provided (e.g. addition of 3’ A overhangs to inserts for TOPO cloning) be sure to use reagents that are of a quality and purity compatible with subsequent parts of a kit. 

* Ensure that samples are extracted in a buffer that is compatible with the reagents supplied. A notable example is the Bradford Protein Assay, which is incompatible with some detergents and substances.

Before Cloning….

For using restriction enzymes to digest and ligate genes of interest into plasmid vectors, it is good practice to check if your restriction enzyme(s) of choice also cuts at regions other than those intended. For standard commercial vectors, these usually have a multiple cloning site (MCS) region containing unique restriction sites where the corresponding enzyme will only cut. However, if you opt to use an enzyme whose site is not present in the MCS, you will need to check if your enzyme(s) of choice cuts anywhere else on the vector.

For your insert, if you decide to engineer restriction sites onto the 5’ and 3’ ends, it is better to (1) choose sites that do not cut anywhere in the insert and (2) make sure the restriction site you are incorporating correspond to what is present in the MCS of the vector.

Some good online tools that are freely available to use for identifying restriction sites in DNA sequences include:

* NEBcutter v2.0

* RestrictionMapper v3

* Webcutter 2.0 

Primer Melting Temperature (Tm)

If you are endeavouring to design your own primers, always bear in mind that the forward and reverse primer T_ms should not be too far apart from one another. Generally, you should aim to have them the same or keep the difference within 2-4 degrees. A way to calculate the primer T_m of your forward and reverse primer sequences is to remember:

A = ~2 degrees

T = ~2 degrees

G = ~4 degrees

C = ~4 degrees

For instance:

Forward: CCGTACATTCGGACATGAGG = C(5x4)+G(6x4)+T(4x2)+A(5x2) = 20+24+8+10 = 62

Reverse: TTGCAAGCTTAAGGCTGACC = C(5x4)+G(5x4)+T(5x2)+A(5x2) = 20+20+10+10 = 60

The ideal PCR annealing temperatures to test should be 2-5 degrees below the primer with the lowest T_m. In this case, the reverse sequence has the lower T_m. When optimizing for the annealing temperature of a PCR, you would in first instance try 55, 56, 57, 58 and 59 degrees.

miRNA/siRNA Knockdown – When Protein Expression Differs From mRNA Levels

A perfect knockdown consists of mRNA reduction and a corresponding change in protein expression. Unfortunately, this is not always the case and there are often times when proteins show an increase or no change. This does not necessarily mean that a knockdown was not effective; rather, it may have occurred because of other cellular processes relating to translation or protein half-life.

Here are a few reasons why your mRNA and protein expression measures may differ:

* If there are multiple alternative transcripts and isoforms of a protein, selective knockdown of one transcript/isoform may lead to increased translation of the other transcripts. If all your isoforms are approximately the same size on a western blot and you do not have a specific antibody targeting your isoform of interest, don’t be surprised if you see an increase in protein expression. The same applies to transcript levels if you are using pan primers.

* MicroRNAs can regulate gene expression by inhibiting translation of existing mRNA and/or promote mRNA degradation. Hence, decreases in target protein expression may not necessarily match the direction of change of mRNA levels. Which route is taken may depend on the degree of base-pairing between the miRNA and miRNA-binding site.

* There can be more than one miRNA recognition element (MRE) for the same or different miRNAs within the 3’UTR of a transcript of interest. Different MREs can function cooperatively to enhance repression. Accordingly, more than one miRNA may be needed for effective knockdown.

* Protein-half life is also relevant. For instance, a target protein containing a PEST sequence will have a short intracellular half-life compared to those that do not.

* The type of protein or function of the protein may also be important. For instance, cell signaling proteins typically have a short-half life whereas glycolytic proteins typically have a long half life.

* Culturing conditions may also influence mRNA and protein expression. For instance, oxidative stress, growth factors, etc will have an impact.

References:

1. Valencia-Sanchez et al. (2006) Control of translation and mRNA degradation by miRNAs and siRNAs. Genes and Development 20:515-524. 

2. To et al. (2008) Regulation of ABCG2 expression at the 3′ untranslated region of its mRNA through modulation of transcript stability and protein translationby a putative microRNA in the S1 colon cancer cell-line. Molecular and Cellular Biology 28:5147-5161. 

3. Wong J. (2014) Regulation of a TrkB Alternative Transcript by microRNAs. Dementia and Geriatric Cognitive Disorders Extra 4:364-74. 

4. Lal et al. (2009) miR-24 inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to ‘seedless' 3′UTR microRNA recognition elements. Molecular Cell 35:610-625. 

5. Franch et al. (2001) A mechanism regulating proteolysis of specific proteins during renal tubular cell growth. The Journal of Biological Chemistry 276, 19126-19131. 

6. Ito et al. (1996) Oxidative stress increases glyceraldehyde-3-phosphate dehydrogenase mRNA levels in isolated rabbit aorta.  American Journal of Physiology 270(1 Pt2):H81-7. 

DNA Gel Extraction and Purification Using Columns

Spin column purification of DNA inserts from agarose gels is a quick and easy process but the downside is that yields are lower compared to DNA purified using a phenol/chloroform extraction protocol. Notwithstanding this, column purification is quite popular and the yields are sufficient for most applications. Interestingly though, there are times when there appears to be no DNA at the end of it.

Something to take note of is the size cut-off of the columns. If you plan on cloning small to very small inserts, pay attention to the kit you are using because you want to avoid having your inserts fall through the filter. Below is a list of various kits and their minimum size cut-offs:

Company	Kit	Minimum Size (bp)
Agilent Technologies	StrataPrep DNA Gel Extraction Kit	100
Merck Millipore	Montage Gel Extraction Kit	100
GenScript	QuickClean II Gel Extraction Kit	100
Qiagen	QIAquick Gel Extraction Kit	70
Omega Bio-tek	E.Z.N.A.® Gel Extraction Kit	70
Macherey-Nagel	NucleoSpin® Gel and PCR Clean-up	50
Affymetrix	PrepEase® Gel Extraction Kit	50
Zymo Research	Zymoclean™ Gel DNA Recovery Kit	50
NEB	Monarch® DNA Gel Extraction Kit	50
Sigma-Aldrich	GenElute™ Gel Extraction Kit	50
Thermo Fisher Scientific	PureLink® Quick Gel Extraction Kit	40

It goes without saying that if you are trying to clone a 48bp insert, you probably don’t want to be using the QIAquick Gel Extraction Kit.