Primer Melting Temperature (Tm)

If you are endeavouring to design your own primers, always bear in mind that the forward and reverse primer T_ms should not be too far apart from one another. Generally, you should aim to have them the same or keep the difference within 2-4 degrees. A way to calculate the primer T_m of your forward and reverse primer sequences is to remember:

A = ~2 degrees

T = ~2 degrees

G = ~4 degrees

C = ~4 degrees

For instance:

Forward: CCGTACATTCGGACATGAGG = C(5x4)+G(6x4)+T(4x2)+A(5x2) = 20+24+8+10 = 62

Reverse: TTGCAAGCTTAAGGCTGACC = C(5x4)+G(5x4)+T(5x2)+A(5x2) = 20+20+10+10 = 60

The ideal PCR annealing temperatures to test should be 2-5 degrees below the primer with the lowest T_m. In this case, the reverse sequence has the lower T_m. When optimizing for the annealing temperature of a PCR, you would in first instance try 55, 56, 57, 58 and 59 degrees.