Designing Primers for Alternative Transcripts #1

Genes are usually expressed as multiple alternative transcripts as a result of alternative splicing of the pre-mRNA. Pan primers amplify all transcripts so the forward and reverse primers are designed to anneal to exons that are common to all transcripts (see figure below).

In order to amplify different alternative transcripts via PCR or real-time PCR, you may need to custom design your own primers if what you need are not commercially available.

Assuming that you are working with a known gene sequence and that you also know which alternative transcripts you want to amplify, you will need to design at least one of your primers, either forward or reverse, to span across adjacent exons. 

For example:

The forward primer spans across exons 1 and 3. This makes the forward primer specific for transcripts which lack exon 2.

To design primers, refer to Primer Design.

Before Cloning….

For using restriction enzymes to digest and ligate genes of interest into plasmid vectors, it is good practice to check if your restriction enzyme(s) of choice also cuts at regions other than those intended. For standard commercial vectors, these usually have a multiple cloning site (MCS) region containing unique restriction sites where the corresponding enzyme will only cut. However, if you opt to use an enzyme whose site is not present in the MCS, you will need to check if your enzyme(s) of choice cuts anywhere else on the vector.

For your insert, if you decide to engineer restriction sites onto the 5’ and 3’ ends, it is better to (1) choose sites that do not cut anywhere in the insert and (2) make sure the restriction site you are incorporating correspond to what is present in the MCS of the vector.

Some good online tools that are freely available to use for identifying restriction sites in DNA sequences include:

* NEBcutter v2.0

* RestrictionMapper v3

* Webcutter 2.0 

Primer Melting Temperature (Tm)

If you are endeavouring to design your own primers, always bear in mind that the forward and reverse primer T_ms should not be too far apart from one another. Generally, you should aim to have them the same or keep the difference within 2-4 degrees. A way to calculate the primer T_m of your forward and reverse primer sequences is to remember:

A = ~2 degrees

T = ~2 degrees

G = ~4 degrees

C = ~4 degrees

For instance:

Forward: CCGTACATTCGGACATGAGG = C(5x4)+G(6x4)+T(4x2)+A(5x2) = 20+24+8+10 = 62

Reverse: TTGCAAGCTTAAGGCTGACC = C(5x4)+G(5x4)+T(5x2)+A(5x2) = 20+20+10+10 = 60

The ideal PCR annealing temperatures to test should be 2-5 degrees below the primer with the lowest T_m. In this case, the reverse sequence has the lower T_m. When optimizing for the annealing temperature of a PCR, you would in first instance try 55, 56, 57, 58 and 59 degrees.

Things To Consider When Ordering Published Primer Sequences

When you see a set of primers in the materials and methods section of a journal publication, it is tempting to order the sequences provided. Before doing so, it is good practice to check the primer sequences to make sure that they are suitable for your needs. In other words, make sure the primer sequences published are suitable for your needs in regards to:

* Cell type – some cell types may have little to no expression of your GOI.

* Tissue type – as with cell type, there may be little to no expression of your GOI.

* Species and percent homology if the species are different.

* Whether the region targeted in the transcript will give you the expected product size when PCR products are run on a gel.

* Primer direction – sometimes the primer sequences provided in a journal article may not be in the correct format for ordering. For instance, if a reverse sequence rather than the reverse complement sequence is provided in the publication, you will have serious issues when you start experimenting with the primers.

* Purpose of the primer – it is important to see what experiments the sequences published were actually used for. A primer set used for expression cloning will not be suitable for real-time PCR.

* The primer sequence published – you want to make sure that the sequences provided are accurate so check by blasting the sequence. It is not uncommon for authors to make typos when entering in their sequences during manuscript preparation.  

PCR Tips & Tricks

Most of you are probably aware of the common variations and tweaks you can do to optimize a PCR reaction, such as changing the MgCl₂ concentrations. But if you are needing to amplify something tricky, such as a transcript with high GC content for cloning, PCR optimization can become a nightmare.

Tip #1 – Re-amplification

When a nested PCR is out of the question, a re-amplification works just as well. The principle is similar to a nested PCR in that you are enriching the region of interest.

Simply run your PCR reaction in a thermocycler for 10-15 cycles and take 0.5ul of the completed reaction to use as template for a second set of reactions.

Tip #2 – Ramping

In some instances where it is difficult to get your primers to hybridize to the correct complementary sequence of your template (e.g. when amplifying a GC rich region, cloning cDNA that has GC or AT strings, etc), a great technique to try is to lower the ramping speed from the denaturation to annealing steps as well as the annealing to extension steps.

The ramping speed is the time it takes for the thermocycler to heat/cool the reaction to a different temperature i.e. to go from 95 degrees to 60 degrees. For instance, by lowering the ramping speed from 100% to 20% you are essentially giving your primers time to hybridize to their complementary sequences on the template. The principle underlying this technique was inspired by the oligo-annealing step of an EMSA protocol.