Designing Primers for Alternative Transcripts #1

Genes are usually expressed as multiple alternative transcripts as a result of alternative splicing of the pre-mRNA. Pan primers amplify all transcripts so the forward and reverse primers are designed to anneal to exons that are common to all transcripts (see figure below).

In order to amplify different alternative transcripts via PCR or real-time PCR, you may need to custom design your own primers if what you need are not commercially available.

Assuming that you are working with a known gene sequence and that you also know which alternative transcripts you want to amplify, you will need to design at least one of your primers, either forward or reverse, to span across adjacent exons. 

For example:

The forward primer spans across exons 1 and 3. This makes the forward primer specific for transcripts which lack exon 2.

To design primers, refer to Primer Design.

Before Cloning….

For using restriction enzymes to digest and ligate genes of interest into plasmid vectors, it is good practice to check if your restriction enzyme(s) of choice also cuts at regions other than those intended. For standard commercial vectors, these usually have a multiple cloning site (MCS) region containing unique restriction sites where the corresponding enzyme will only cut. However, if you opt to use an enzyme whose site is not present in the MCS, you will need to check if your enzyme(s) of choice cuts anywhere else on the vector.

For your insert, if you decide to engineer restriction sites onto the 5’ and 3’ ends, it is better to (1) choose sites that do not cut anywhere in the insert and (2) make sure the restriction site you are incorporating correspond to what is present in the MCS of the vector.

Some good online tools that are freely available to use for identifying restriction sites in DNA sequences include:

* NEBcutter v2.0

* RestrictionMapper v3

* Webcutter 2.0 

Primer Melting Temperature (Tm)

If you are endeavouring to design your own primers, always bear in mind that the forward and reverse primer T_ms should not be too far apart from one another. Generally, you should aim to have them the same or keep the difference within 2-4 degrees. A way to calculate the primer T_m of your forward and reverse primer sequences is to remember:

A = ~2 degrees

T = ~2 degrees

G = ~4 degrees

C = ~4 degrees

For instance:

Forward: CCGTACATTCGGACATGAGG = C(5x4)+G(6x4)+T(4x2)+A(5x2) = 20+24+8+10 = 62

Reverse: TTGCAAGCTTAAGGCTGACC = C(5x4)+G(5x4)+T(5x2)+A(5x2) = 20+20+10+10 = 60

The ideal PCR annealing temperatures to test should be 2-5 degrees below the primer with the lowest T_m. In this case, the reverse sequence has the lower T_m. When optimizing for the annealing temperature of a PCR, you would in first instance try 55, 56, 57, 58 and 59 degrees.

Cloning Tip – How Not To Expose Inserts To UV During Preparation

As mentioned in a previous post¹ there is a way that you can isolate PCR-amplified inserts from DNA agarose gels without exposure of the insert to UV.

First, create replicates of your insert by amplifying multiple PCR reactions.  I generally prepare between 3-5 replicate reactions to increase my insert yield. Prepare a 1% agarose gel + ethidium bromide. After your PCR goes to completion, cool the reactions to 4 degrees or leave it on ice. Add loading dye and load the reactions onto your gel. In the lanes indicated with the letter “L”, add your DNA ladder. I have used a 100bp ladder as an example.

Run the gel. Once completed, remove the gel from the tank and cut the gel as indicated by the red dashed line. Take the smaller portion of the gel to a dark room and visualize on an open UV box. Take a blade or scalpel and mark the gel by nicking the gel edge just above and below the band of interest (green) as indicated by the asterisks. 

Reassemble the entire gel at your bench and then using the nicks made to the gel and the ladders as a guide, carefully cut out the area where your replicate bands of interest are likely to lie as indicated by the dashed red lines.

Gel purify the gel cut-outs containing your bands of interest (green) and proceed with your cloning protocol.

TOPO TA Cloning – Adding 3’A Overhangs

The TOPO TA cloning kits for subcloning offer an easy way to subclone effectively, provided you can get it to work for you.  The topoisomerase I in which the kit relies on requires the presence of 3’A overhangs on the DNA inserts in order to catalyze the reaction joining insert to vector. Ironically, the enzymes and other components required to add the 3’A overhangs are not supplied with the kits and the protocol provided in the instruction manual is not what I consider ideal.

I have personally never followed the 3’A overhang procedure set out in the product manuals provided; instead, I used my own, which I believe works out more efficiently.

The following is a quick and general run-down of how I clone using the TOPO TA subcloning kits. The focus will be on the addition of 3’A overhangs.

Insert Preparation

* Setup PCR reactions to amplify your insert. Use a proofreading DNA polymerase.

* Run your DNA gels and cut out your insert. If you do not want any possibility of point mutations or DNA breakage, try excising your bands without exposure to any UV.

* Gel purify your gel cut-outs. I recommend using a kit such as Qiagen's QIAquick Gel Extraction Kit. Elute/resuspend the DNA in nuclease-free water.

Adding 3’A Overhangs

Proofreading DNA polymerases have 5' to 3' polymerization and exonuclease activity as well as 3’ to 5’ exonuclease activity (proofreading). It is the 3’ to 5’ exonuclease activity of a proofreading DNA polymerase which enables it to remove any base-pair mismatch, including any overhanging bases, thereby generating blunt-end PCR products. In contrast, Taq DNA polymerases lack the 3' to 5' exonuclease activity, so while Taq enzymes are not suitable for generating inserts for cloning, they are useful for TA cloning for the addition of 3’A overhangs.

* You will need a Taq DNA polymerase which does not have 3’ to 5’ exonuclease activity. Check the product information sheet. An example of such a Taq is Thermo Scientific's Red Hot Taq DNA Polymerase.

* Using the Red Hot Taq as an example, set up the following:

For x1 reaction:

10x PCR Buffer à 2.5ul

MgCl₂ à 2ul

dATP (10mM stock) à 0.5ul

Red Hot Taq à 0.1ul

Insert DNA (from gel extraction) à 19.9ul

Incubate in a PCR thermal cycler à 72 degrees for 30 minutes. Do not cycle. Cool on ice or 4 degrees when complete.

DNA Precipitation

Cool your reaction on ice and proceed to precipitate your DNA inserts.

* Take the above 25ul reaction and add 2.5ul (which is 1/10^th volume) of 3M pH5.2 NaAc (sodium  acetate). Tap or gently vortex to mix.

* Add 62.5ul (which is 2.5 volumes of ice cold absolute ethanol). Tap or gently vortex to mix.

* Incubate the entire reaction on ice for 30 minutes.

* Centrifuge at 16200xg for 20 minutes.

* Aspirate the supernatant and wash the pellet with 500ul of 70% ethanol.

* Centrifuge at 16200xg for 5 minutes.

* Aspirate the supernatant, air dry the pellet and resuspend in 10ul nuclease-free water.

* Use 4ul for TOPO cloning reaction.

Ways To Ensure Experimental Consistency #2

The following is pretty obvious but does deserve a mention because sometimes, the obvious get overlooked.

Aliquoting

Some things don’t handle temperature changes too well and there are going to be times when enzymes, antibodies, etc get forgotten and left out on the bench for way longer than it should. As such, it is good practice to make aliquots because if something goes wrong, you will have backups! For instance, if you want to preserve your PCR enzyme and keep it at maximal efficiency for the life of the kit (i.e. however long it takes you to use it up), make aliquots of the polymerase. That way, the enzyme will undergo less freeze-thaw cycles and if you happen to forget about it and leave it out on the bench overnight, you can just grab a new aliquot. The same applies for antibodies. 

Mixing

Reagents, samples and solutions, etc sit around frozen, chilled or at room temperature waiting for us to use them. While they sit and wait, some chemicals will separate or you might get precipitates (think SDS falling out of solution when it gets cold). If you have solutions in large 1L clear bottles, it would be pretty easy to see, but if you had frosted 1.5-2ml microfuge/screw cap tubes or those brown opaque ones, it’s not going to be obvious (if at all). For instance, if you defrost your dNTP mix for PCR without giving it a good mix before taking a few mircoliters for your mastermix, would you expect to have a equivalent concentrations of all 4 dNTPs? So unless there is good reason not to mix something, its good practice to give small tubes a quick vortex and pulse spin to mix up the contents.

Other Things To Consider

* Use filter pipette tips. These come sterilized and DNase/RNase-free. The filter also prevents liquids and vapors from volatile solutions from going into the pipette barrel.

* Calibrate your pipettes regularly.

* Clean out the pipette barrel. It is amazing how much build-up you can get in the pipette barrel. You probably don’t need to do this as often if you are using filter pipette tips, but if you are not using filter tips, clean it regularly.

* If you make your own solutions, make sure that the date the solution is made, storage temperature and maker are clearly labeled.

* Some antibodies are very temperamental. If you get a batch that works, make sure to order a few more from the same batch.