Showing posts with label primer design. Show all posts
Showing posts with label primer design. Show all posts

Wednesday, 7 December 2016

Designing Primers for Alternative Transcripts #1

Genes are usually expressed as multiple alternative transcripts as a result of alternative splicing of the pre-mRNA. Pan primers amplify all transcripts so the forward and reverse primers are designed to anneal to exons that are common to all transcripts (see figure below).

In order to amplify different alternative transcripts via PCR or real-time PCR, you may need to custom design your own primers if what you need are not commercially available.

Assuming that you are working with a known gene sequence and that you also know which alternative transcripts you want to amplify, you will need to design at least one of your primers, either forward or reverse, to span across adjacent exons. 

For example:


The forward primer spans across exons 1 and 3. This makes the forward primer specific for transcripts which lack exon 2.

To design primers, refer to Primer Design.

Monday, 6 June 2016

Primer Melting Temperature (Tm)

If you are endeavouring to design your own primers, always bear in mind that the forward and reverse primer Tms should not be too far apart from one another. Generally, you should aim to have them the same or keep the difference within 2-4 degrees. A way to calculate the primer Tm of your forward and reverse primer sequences is to remember:

A = ~2 degrees
T = ~2 degrees
G = ~4 degrees
C = ~4 degrees

For instance:

Forward: CCGTACATTCGGACATGAGG = C(5x4)+G(6x4)+T(4x2)+A(5x2) = 20+24+8+10 = 62

Reverse: TTGCAAGCTTAAGGCTGACC = C(5x4)+G(5x4)+T(5x2)+A(5x2) = 20+20+10+10 = 60


The ideal PCR annealing temperatures to test should be 2-5 degrees below the primer with the lowest Tm. In this case, the reverse sequence has the lower Tm. When optimizing for the annealing temperature of a PCR, you would in first instance try 55, 56, 57, 58 and 59 degrees.

Tuesday, 9 February 2016

Things To Consider When Ordering Published Primer Sequences

When you see a set of primers in the materials and methods section of a journal publication, it is tempting to order the sequences provided. Before doing so, it is good practice to check the primer sequences to make sure that they are suitable for your needs. In other words, make sure the primer sequences published are suitable for your needs in regards to:

* Cell type – some cell types may have little to no expression of your GOI.
* Tissue type – as with cell type, there may be little to no expression of your GOI.
* Species and percent homology if the species are different.
* Whether the region targeted in the transcript will give you the expected product size when PCR products are run on a gel.
* Primer direction – sometimes the primer sequences provided in a journal article may not be in the correct format for ordering. For instance, if a reverse sequence rather than the reverse complement sequence is provided in the publication, you will have serious issues when you start experimenting with the primers.
* Purpose of the primer – it is important to see what experiments the sequences published were actually used for. A primer set used for expression cloning will not be suitable for real-time PCR.

* The primer sequence published – you want to make sure that the sequences provided are accurate so check by blasting the sequence. It is not uncommon for authors to make typos when entering in their sequences during manuscript preparation.  

Saturday, 2 January 2016

Primer Design - Be Your Own Designer!

PCR primers


While there are a number of ways to obtain a set of PCR primers to amplify your GOI, sometimes, you might just need to customize your own to zero in on a particular region to specifically amplify a transcript variant. The following method is a timeless protocol for those who like to design their own primers.

Preparation
First, you will need the cDNA sequence of your GOI. The sequence should ideally have the intron-exon boundaries clearly marked. For this I recommend getting the cDNA sequence from Ensembl as they have an option that allows users to mark the exons using an alternating color scheme (see below).

Screen capture of the exon sequences from the ABCA1 transcript variant 1 from Ensembl


Alternatively, you could just get the cDNA sequence and mark out the intron-exon boundaries yourself.

Ideally, you will want your primers to cover an intron-exon boundary. Crossing an intron-exon boundary will ensure that your primers are annealing to and only amplifying from your cDNA template rather than gDNA contamination. If your primers can anneal to both cDNA and gDNA, on an agarose gel, the gDNA will either give you a higher MW band, become a smear, or be the exact same size as your cDNA PCR product. Either way, gDNA contamination will affect quantification and subsequent analyses.

Primer design:
* You will want your primers to be ~20 nucleotides long and to have ~50% GC.
* Do not have strings of >3 nucleotides of any kind (e.g. AAAAA or GGG or TTTT or CCCCC).
* At the 5’ end, start with A or T nucleotides; at the 3’ end, have G or C nucleotides as the last 3 nucleotides. This will give a stronger bond to the 3’ end; you do not want the 5’ end to have too tight a bond.
* Aim for a product size of ~200bp.
* When ordering, standard desalt purification is fine for PCR and cloning.