Before Cloning….

For using restriction enzymes to digest and ligate genes of interest into plasmid vectors, it is good practice to check if your restriction enzyme(s) of choice also cuts at regions other than those intended. For standard commercial vectors, these usually have a multiple cloning site (MCS) region containing unique restriction sites where the corresponding enzyme will only cut. However, if you opt to use an enzyme whose site is not present in the MCS, you will need to check if your enzyme(s) of choice cuts anywhere else on the vector.

For your insert, if you decide to engineer restriction sites onto the 5’ and 3’ ends, it is better to (1) choose sites that do not cut anywhere in the insert and (2) make sure the restriction site you are incorporating correspond to what is present in the MCS of the vector.

Some good online tools that are freely available to use for identifying restriction sites in DNA sequences include:

* NEBcutter v2.0

* RestrictionMapper v3

* Webcutter 2.0 

Calculating the Geometric Mean/Geomean of Housekeeping Genes from Real-Time PCR Data Using Excel

In real-time PCR, it is not uncommon for multiple housekeeping genes to be used for normalising data. Knowing how to calculate an average for your housekeeping genes will be useful regardless of whether you opt to carry out relative or absolute quantification of your gene of interest.

If you are using three or more housekeeping genes, you can calculate the geometric or geomean easily using Excel.

Cell Formulae

Column B: Gene 1 CT values from your qPCR run

Column C: Gene 2 CT values from your qPCR run

Column D: Housekeeping gene 1 CT values from your qPCR run

Column E: Housekeeping gene 2 CT values from your qPCR run

Column F: Housekeeping gene 3 CT values from your qPCR run

Column G: =GEOMEAN(D4:F4) and copy/paste formula down to G18

Epigenetics – The nth DNA Base

Classically, DNA is thought to comprise 4 nucleotide bases: adenine, thymine, cytosine, and guanine (A, T, C, and G). However, the discovery and identification of variants of the classical 4 bases including 5-methylcytosine, 5-hydroxymethylcytosine, and 5-formylcytosine in human and mouse brain tissues has revolutionized the conception of DNA, its composition, regulation and expression.

While the sequence of the 4 classical bases determine what genes encode, the additional bases are involved in controlling how DNA sequences are interpreted, what genes are expressed, and importantly when genes are expressed. For instance, epigenetic modifications made to cytosine can affect the DNA structure by exposing regions of the DNA to attract different proteins and transcription factors, which could either directly or indirectly influence which genes are expressed or repressed.

* 5-Methylcytosine is formed by the addition of a methyl group to the 5th carbon of cytosine. This process typically occurs at cytosines located in CpG dinucleotide sequences, although, methylation has also been found to occur at non-CpG dinucleotide sites. 5-Methylcytosine has been shown to function as a repressor of gene transcription. In the promoters of genes, 5-methylcytosine is associated with stable, long-term transcriptional silencing. By enabling genes to be turned on and off in specific cell types, the gene regulatory function of 5-methylcytosine is an important mechanism in mediating genomic imprinting, controlling cellular differentiation, and the expression of specific genes for normal tissue patterning and development.

* 5-Hydroxymethylcytosine is abundant in the brain and in embryonic stem cells. It is formed by oxidation of 5-methylcytosine and reduced levels of this cytosine variant in DNA has been regarded as a hallmark of cancer. Genomic profiling of 5-hydroxymethylcytosine has revealed that in contrast to 5-methylcytosine, 5-hydroxymethylcytosine is particularly associated with gene regulatory elements where 5-methylcytosine is depleted. 5-Hydroxymethylcytosine has been found to be associated with cell proliferation, having been demonstrated to form immediately during DNA replication at the stage of synthesis via isotopic labelling studies of DNA in mouse tissues.

* 5-Formylcytosine is derived from 5-methylcytosine by Tet-mediated oxidation. In mice, 5-formylcytosine has been found to be present in all tissues, including embryonic tissues, and preferentially occurs at poised enhancers among other gene regulatory elements. 5-Formylcytosine has been implicated in various roles including demethylation, chromatin remodeling, and DNA structural changes such as changes to groove geometry and base pairs associated with 5-formylcytosine-modified bases that lead to helical underwinding.

References:

1. Cadet and Wagner. (2014) TET Enzymatic Oxidationof 5-Methylcytosine, 5-Hydroxymethylcytosine and 5-Formylcytosine. MutationResearch/Genetic Toxicology and Environmental Mutagenesis 764–765: 18–35.

2. Wanger et al. (2015) Age-DependentLevels of 5-Methyl-, 5-Hydroxymethyl-, and 5-Formylcytosine in Human and MouseBrain Tissues. Angewandte Chemie (International Ed. in English) 54:12511–12514.

3. Yu et al. (2013) DevelopmentallyProgrammed 3’ CpG Island Methylation Confers Tissue- and Cell-Type-SpecificTranscriptional Activation. Molecular and Cellular Biology 33: 1845–1858.

4. Butler MG. (2009) Genomic Imprinting Disordersin Humans: A Mini-Review. Journal of Assisted Reproduction and Genetics 26:477–486.

5. Bachman et al. (2014) 5-Hydroxymethylcytosineis a Predominantly Stable DNA Modification. Nature Chemistry 6: 1049–1055.

6. Raiber et al. (2015) ​5-Formylcytosine Altersthe Structure of the DNA Double Helix. Nature Structural and Molecular Biology22: 44–49.

7. Ito et al. (2011) Tet Proteins can Convert5-Methylcytosine to 5-Formylcytosine and 5-Carboxylcytosine. Science 333:1300-1303.

8. Song et al. (2013) Genome-wide profilingof 5-formylcytosine reveals its roles in epigenetic priming. Cell 153: 678–691.

Primer Melting Temperature (Tm)

If you are endeavouring to design your own primers, always bear in mind that the forward and reverse primer T_ms should not be too far apart from one another. Generally, you should aim to have them the same or keep the difference within 2-4 degrees. A way to calculate the primer T_m of your forward and reverse primer sequences is to remember:

A = ~2 degrees

T = ~2 degrees

G = ~4 degrees

C = ~4 degrees

For instance:

Forward: CCGTACATTCGGACATGAGG = C(5x4)+G(6x4)+T(4x2)+A(5x2) = 20+24+8+10 = 62

Reverse: TTGCAAGCTTAAGGCTGACC = C(5x4)+G(5x4)+T(5x2)+A(5x2) = 20+20+10+10 = 60

The ideal PCR annealing temperatures to test should be 2-5 degrees below the primer with the lowest T_m. In this case, the reverse sequence has the lower T_m. When optimizing for the annealing temperature of a PCR, you would in first instance try 55, 56, 57, 58 and 59 degrees.

Dithiothreitol (DTT) vs Beta-mercaptoethanol (BME)

DTT and BME are reducing agents used for the chemical reduction of disulfide bonds. They are commonly added to SDS-PAGE sample buffers and are often used interchangeably. While both DTT and BME are used to achieve the same purpose in SDS-PAGE, they exhibit different chemical properties.

BME

This is very volatile and readily evaporates from solution. Because of its volatility and toxicity, solutions of BME are often handled in a fume cupboard. The disadvantage of this is that frequent usage will increase the rate of evaporation, leading to a decrease in the concentration of a solution of BME over time.

The issue with this is that the chemical reduction of disulfide bonds within proteins and peptides is an equilibrium reaction where bonds are continually breaking and re-forming. Accordingly, excess BME is required to drive the reaction forward to completion. Reciprocally, insufficient quantities of BME in a given reaction will not adequately reduce all protein disulfide bonds with some bonds undergoing reoxidation.

DTT

This is volatile but not to the extent as BME. Unlike BME, the chemical reaction in reducing disulfide bond linkages within proteins and peptides is not an equilibrium reaction. A disulfide reduction reaction using DTT leads to an irreversible change in the DTT molecule where its straight chain structure is altered to a ring structure. Accordingly, use of DTT will avoid issues of disulfide bond reoxidisation. However, DTT is unstable in solution and must be made fresh each time.