Epigenetics – The nth DNA Base

Classically, DNA is thought to comprise 4 nucleotide bases: adenine, thymine, cytosine, and guanine (A, T, C, and G). However, the discovery and identification of variants of the classical 4 bases including 5-methylcytosine, 5-hydroxymethylcytosine, and 5-formylcytosine in human and mouse brain tissues has revolutionized the conception of DNA, its composition, regulation and expression.

While the sequence of the 4 classical bases determine what genes encode, the additional bases are involved in controlling how DNA sequences are interpreted, what genes are expressed, and importantly when genes are expressed. For instance, epigenetic modifications made to cytosine can affect the DNA structure by exposing regions of the DNA to attract different proteins and transcription factors, which could either directly or indirectly influence which genes are expressed or repressed.

* 5-Methylcytosine is formed by the addition of a methyl group to the 5th carbon of cytosine. This process typically occurs at cytosines located in CpG dinucleotide sequences, although, methylation has also been found to occur at non-CpG dinucleotide sites. 5-Methylcytosine has been shown to function as a repressor of gene transcription. In the promoters of genes, 5-methylcytosine is associated with stable, long-term transcriptional silencing. By enabling genes to be turned on and off in specific cell types, the gene regulatory function of 5-methylcytosine is an important mechanism in mediating genomic imprinting, controlling cellular differentiation, and the expression of specific genes for normal tissue patterning and development.

* 5-Hydroxymethylcytosine is abundant in the brain and in embryonic stem cells. It is formed by oxidation of 5-methylcytosine and reduced levels of this cytosine variant in DNA has been regarded as a hallmark of cancer. Genomic profiling of 5-hydroxymethylcytosine has revealed that in contrast to 5-methylcytosine, 5-hydroxymethylcytosine is particularly associated with gene regulatory elements where 5-methylcytosine is depleted. 5-Hydroxymethylcytosine has been found to be associated with cell proliferation, having been demonstrated to form immediately during DNA replication at the stage of synthesis via isotopic labelling studies of DNA in mouse tissues.

* 5-Formylcytosine is derived from 5-methylcytosine by Tet-mediated oxidation. In mice, 5-formylcytosine has been found to be present in all tissues, including embryonic tissues, and preferentially occurs at poised enhancers among other gene regulatory elements. 5-Formylcytosine has been implicated in various roles including demethylation, chromatin remodeling, and DNA structural changes such as changes to groove geometry and base pairs associated with 5-formylcytosine-modified bases that lead to helical underwinding.

References:

1. Cadet and Wagner. (2014) TET Enzymatic Oxidationof 5-Methylcytosine, 5-Hydroxymethylcytosine and 5-Formylcytosine. MutationResearch/Genetic Toxicology and Environmental Mutagenesis 764–765: 18–35.

2. Wanger et al. (2015) Age-DependentLevels of 5-Methyl-, 5-Hydroxymethyl-, and 5-Formylcytosine in Human and MouseBrain Tissues. Angewandte Chemie (International Ed. in English) 54:12511–12514.

3. Yu et al. (2013) DevelopmentallyProgrammed 3’ CpG Island Methylation Confers Tissue- and Cell-Type-SpecificTranscriptional Activation. Molecular and Cellular Biology 33: 1845–1858.

4. Butler MG. (2009) Genomic Imprinting Disordersin Humans: A Mini-Review. Journal of Assisted Reproduction and Genetics 26:477–486.

5. Bachman et al. (2014) 5-Hydroxymethylcytosineis a Predominantly Stable DNA Modification. Nature Chemistry 6: 1049–1055.

6. Raiber et al. (2015) ​5-Formylcytosine Altersthe Structure of the DNA Double Helix. Nature Structural and Molecular Biology22: 44–49.

7. Ito et al. (2011) Tet Proteins can Convert5-Methylcytosine to 5-Formylcytosine and 5-Carboxylcytosine. Science 333:1300-1303.

8. Song et al. (2013) Genome-wide profilingof 5-formylcytosine reveals its roles in epigenetic priming. Cell 153: 678–691.

Primer Melting Temperature (Tm)

If you are endeavouring to design your own primers, always bear in mind that the forward and reverse primer T_ms should not be too far apart from one another. Generally, you should aim to have them the same or keep the difference within 2-4 degrees. A way to calculate the primer T_m of your forward and reverse primer sequences is to remember:

A = ~2 degrees

T = ~2 degrees

G = ~4 degrees

C = ~4 degrees

For instance:

Forward: CCGTACATTCGGACATGAGG = C(5x4)+G(6x4)+T(4x2)+A(5x2) = 20+24+8+10 = 62

Reverse: TTGCAAGCTTAAGGCTGACC = C(5x4)+G(5x4)+T(5x2)+A(5x2) = 20+20+10+10 = 60

The ideal PCR annealing temperatures to test should be 2-5 degrees below the primer with the lowest T_m. In this case, the reverse sequence has the lower T_m. When optimizing for the annealing temperature of a PCR, you would in first instance try 55, 56, 57, 58 and 59 degrees.